Sithking: This is the result of a collaborative project over on the Spacebattles forums based on an idea originally from Harry Leferts. Jurassic Park, Mass Effect, and all associated properties belong to their respective owners.

Tyrant Kings:

Chapter One

"Well, what about Herds-Prey-Beasts?"

"Definitely not. The Hegemony may have mellowed out, but they'd still cause a political shitstorm the likes of which GOD has never seen if we make the Butcher of Torfan our candidate."

"Agreed. Well, then there's Jix…"

"The Lion of Elyssium would make an attractive candidate."

"I'm afraid Jix tendered her resignation two days ago, something… came up for her."

"'Something'?"

"She's getting ready to lay her first clutch."

"Oh. Understandable then."

"There's Jok'ua Mgumbe…"

"His records are impressive, and he did survive that nest of Thresher Maws on Akuze when the rest of his unit perished."

"And unfortunately, he's still recovering from that- psychologically, he's in no condition to head back into the field, or make the kind of decisions that he'd be required to."

"I have this report for a 'Captain Anderson' that might-"

"The one who snapped and nearly strangled the Hanar Ambassador?"

"Hm. Yes, I forgot about that… Wasn't even aware it was possible to strangle a Hanar."

"Men- or Martians, for that matter- can get rather creative when they hit their limits."

"So we're forgetting that one, then."

"Agreed."

"Agreed."

"What about Shepard?"

"Well, she's still in command of the Peregrine, correct? I understand that she's a 'Rex, but having banana-sized teeth doesn't-"

"No, not her, the younger Shepard, Stephen."

"Oh, right. Hm. Excellent scores, psychological profile reads stable…"

"Took down that Slaver Nest in the 'Verge last September… Assisted in that Cloning Lab takedown with Blackwatch… Found the Prothean Warship…"

"Not to mention photogenic and soft-spoken."

"…"

"…"

"If he does become the first Terran SPECTRE, do you really think we won't be using him on recruitment posters?"

"Of course we will, but I'd hardly put 'Good Looks' as a reason to be a SPECTRE."

"I was just thinking out loud!"

"Fine, fine. If there are no other candidates?"

"…"

"…"

"Excellent. I think we have our man. Get a dossier ready for the Council, I'll prepare the Transfer Orders…"

IN 1993 WE UNCOVERED THE POWER OF THE ANCIENT PAST, AND WITH IT, WE UNLOCKED THE SECRETS OF GENETICS AND SCIENCE. WE HAVE ADVANCED AS A SOCIETY AND HAVE MOVED FORWARD WITH LEAPS AND BOUNDS, AIDED BY OUR OWN CREATIONS. WITH THEM, WE VISITED THE STARS.

IN 2099, WE DISCOVERED SOMETHING EVEN MORE SHOCKING- THAT WE WERE NOT ALONE IN THE UNIVERSE. WE FOUND THE SECRETS OF THE GALAXY IN RUINS ON MARS.

IN 2196 WE NOW USE THESE DISCOVERIES TO TRAVERSE THE GALAXY IN THE BLINK OF AN EYE. OUR ANCESTORS WOULD HAVE CALLED IT A MIRACLE.

WE CALL IT…

MASS EFFECT

TYRANT KINGS

CHAPTER 1

The gleaming hull of the SR-1 shone in the brief sunlight of an otherwise overcast London day, causing a young man to pause and shield his eyes. A four-eyed woman bumped into him, muttering angrily under her breath as he stared at his new posting.

The Normandy.

An experimental frigate, produced by the Salarian Union and the Terran Systems Alliance, it had been hotly contested by officers across the Alliance for what had been seen as a choice posting. It was packed with the most advanced technology the two nations could buy, ranging from those as simple as gravity plating a mere 1.2% more efficient than the competition, to the mighty Tantalus Core, which gave the ship unparalleled maneuverability and strength.

To Stephen Shepard, it was fascinating.

The Salarian influence was obvious- very few right angles in the design, a sleek, almost cylindrical main hull, and dark grey coloration screamed at their influence. But her heart was pure Terran, nearly half a kilometer long and bristling with concealed and not-so-concealed weapons, and with the name proudly stamped on the side: TNS Normandy.

Stephen gazed proudly at his new posting, even as he fished into his Uniform's pocket to present to the Dilophosaur guard his identification. She gingerly picked up the plastic card, gave it a quick once-over, and handed it back, giving him a nod before turning her attention towards the Protoceratops holding its own card in its mouth.

"Commander Shepard!" barked a harsh, deep voice, causing Shepard to drop his bag and stand ramrod-straight, startling a previously engrossed raptor at the Navigation station next to the airlock, "I don't recall you asking to come aboard my ship."

A grin spread across Stephen's face. "My apologies, Sir! Permission to come aboard, Captain Anderson!"

A warm smile wrinkled the leathery skin of the Martian as he stepped forward to clap a hand onto the human's shoulder. "Permission granted, son. It'll be good to have at least one familiar face on board."

Stephen relaxed and smirked, "You know, mom says-"

"You tell her she can keep asking until Hammond comes back from the grave, but she cheated with that inside flush, and she knows it!"

Shepard let out a bark of laughter, "You can tell her that the next time you see her, then she'll stop sending me to hound you."

"Your mother is twenty feet tall and has teeth longer than my fingers. I didn't get to be captain by making suicidally stupid decisions," he deadpanned as the two began walking along the main hallway, towards the glowing holographic map of the galaxy.

"That incident with the Hanar begs to differ, sir."

"It got me off of that blasted station, didn't it? Now go and get changed, son- your shift starts at twelve hundred."

ACTGACTGACTGACTGACTGACTGACTGACTGACTG

"You know, I swear I've heard your voice before."

Kaiden Alenko sighed. "No, you haven't, Joker."

"No, no, trust me, I may not be able to take a piss without help, but voices? Voices are what I'm good at." A pause. "Well, that and flying, I mean."

"I can't think of anywhere that you'd have heard my voice before. Maybe back in the London Arcology?"

Joker shook his head. "Haven't left the ship since Arcturus, trust me, this is the first time we've met. But I swear I've heard your voice before."

"You probably have, human," came a high, reedy voice from behind them as Jondam Bau, SPECTRE of the Citadel Council and former member of the STG, stepped onto the bridge. "After all, he's-"

"Alright, I did a few PSA announcements for the Ascension program, to help entice it to new Biotics," blurted Kaiden, shooting a glare at the smug-looking amphibian, "I don't like to talk about it much, never liked how my voice sounded in those. Can we please drop it?"

"PSA's? Huh, didn't think you seemed like the type…" Muttered Joker as he approached the huge, spinning construct, "Approaching Charon Relay, activation in five, four, three, two…" but was cut off as the ship gave a titanic lurch as it was catapulted light years away.

"Charon-Arcturus Transition complete. No anomalies detected. Speed… 20,000 KPH, drift, just under 1,500 K."

"How many relay jumps have you done, Mr. Moreau?"

"Uh… This would be my fourth actual, sir."

Jondam let out a swift chuckle. "Better than my fourth… I never really had a hand for piloting. I came out of the relay sideways. Still don't know how that happened. Your captain should be pleased, but please forward the data on the jump to the computer core, we should be able to shave off at least 200 K from the drift."

"Yessir," Joker responded as Jondam walked away.

Silence filled the cockpit.

"I hate that guy."

"He seemed all right to me," said Joker, before grinning. "How the hell do you do a relay jump sideways? That's a hell of a neat trick."

"He just rubbed me the wrong way, all right?"

"All he did was point out that you were in some PSA's. What's so bad about that?"

"I don't want to talk about it."

"All right, all right, just don't blame me if your Wikipedia entry gets a few peeks tonight…"

"Go ahead, I have nothing to hide," Kaiden replied placidly, not letting the smirk show on his face. After all, he was the one who wrote the article…

ACTGACTGACTGACTGACTGACTGACTGACTGACTG

EDEN PRIME

"LEFT CLAW!" roared the drill instructor.

As one, fifty scaled legs lashed out, neatly slicing across the asarinoid dummies' left pectorals with wicked precision.

"RIGHT CLAW!"

As one, the group turned and attacked once again, this time using their other leg, carving a gash into the dummies' right pectoral.

"OMNIS!"

Fifty Raptor Talons glowed orange, and the dummies tumbled to the ground far below them in two pieces.

"Excellent work, recruits!" came the voice of General Artanus, hovering out to meet them on a floating platform. Some of the raptors glared at the slightly smug Turian General, but as the leader of the 26th Armiger Legion and one of the most vocal voices behind the project, he demanded respect.

"Ten years ago was the first graduating class of the 212th Nublarian Combat Regiment, and each year since your numbers have grown. As we speak, hundreds of your fellow soldiers are fighting battles across known space against threats ranging from Seperatists to pirates to Terminus Warlords.

"When you leave this facility today, know that you will be among the most elite soldiers that the Terran Systems Alliance has ever produced, and even beyond the borders of the Alliance, the renown of the 212th echoes far and wide. Take heart, for-" and then he paused. Raising his arm, he began tapping his omnitool. An increasingly worried look accumulated on his face, causing the raptors of the 212th to shift nervously and mutter softly to one another.

"Unfortunately," his voice boomed, "We're going to have to cut this short. Report to the Briefing Room immediately. A situation has just come up…"

He hesitated for a moment as the murmuring increased.

"It seems a large group of ships has just emerged from the relay… and preliminary reports state that they just took out the McKinley Transit Observation Station."

ACTGACTGACTGACTGACTGACTGACTGACTGACTG

"This is the Deployment Bay, it runs through most of the lower two decks," announced Anderson proudly. "From here, we have enough room to outfit even a Tyrannosaurus with a Weapon Pack and still have enough room for three Pteranodrones and a Mako ATV."

"Just a Mako?" asked Stephen skeptically. "I was hoping for one of the Otodus Tanks…"

Anderson snorted. "And I suppose you'd like orbital fire support on every mission, or a planet made entirely of Eezo? Get real, Shepard, this is supposed to be a stealth ship."

"Thus why it's half a klick long and outfitted with three Pteranodrones and countless missiles."

"Anyone ever tell you that backsassing a superior officer is a bad career move, Commander?"

"Sorry, sir."

"It's all right, son- personally, I agree. Much as I like the Salarians, sometimes I don't think that they were quite ready to deal with people who mass more than aircars… or had our unique design philosophy."

"What about the Krogan, Sir?"

"They day they start treating us like them is going to be a very bad day in my book, son."

The door behind them hissed open, revealing a lanky blonde man carrying a datapad.

"Sir, the status updates on the engines you requested."

"Ah, thank you ensign. Ensign Richard L. Jenkins, Commander Stephen S. Shepard. He's going to be the new XO on the Normandy."

Jenkins snapped a salute to Shepard, though a certain glimmer had entered into his eyes now.

"Sir! A pleasure to meet you sir!"

"Just out of basic, huh, ensign?"

"Sir! It's my first tour of duty, sir!"

"I can see that."

"Permission to speak freely, sir?"

Shepard glanced at Anderson, then nodded.

"Sir, I was at Torfan… if your mother hadn't pulled that stunt with her ship, myself and everyone else there wouldn't be here today. I know I'm not the only one who wants to personally shake her hand…" Shepard raised an eyebrow at this, "So to speak, that is."

Anderson gave a quizzical expression at the ensign. "Wait, how were you at Torfan if this is your first tour of duty?"

At this Jenkins stiffened before rubbing the back of his neck self-consciously, allowing Shepard to see the edge of what looked like a ropey burn scar.

"I… I wasn't there by choice, sir… If it's all right, I'd rather not talk about it."

The two senior officers winced. It was common knowledge that while attempting to raid TSA colonies was exceedingly dangerous to slavers, there were still raids that had succeeded, despite the TSA's best efforts.

"Say no more, ensign," Anderson replied in a fatherly tone, "I apologize for bringing it up."

"It was a long time ago, sir… I'm mostly over it now." He gave a cocky grin, "Plus, next time I face some slavers, I'll be wearing a portable gattling guns, so it probably won't end the same way."

The three chuckled briefly.

"Is there anything else you need, ensign?" came a rapid voice from the doorway.

Jenkins jumped slightly before turning and fired out rapidly "No sir, just delivering some status updates to Captain Anderson."

Jondam Bau passed through the doorway and stood at attention. "Then if you don't mind, ensign, I have some matters that need discussing with the Captain and the XO. Classified matters."

"O-of course, sir," he stammered, recognizing the dismissal for what it was and dashing out of the observation deck.

The Martian shot a glare at the Spectre. "Intimidating an ensign isn't very friendly."

"But highly amusing, one must admit," Jondam parried, "And I was hoping that you would be done giving Shepard the dollar tour and told him what's really going on."

"'What's really going on?' What, are you inducting me into a secret club, Anderson?" Shepard snarked.

The two gave level stares at Stephen.

"Oh god, you are."

"In a manner of speaking… This" and at that, Jondam activated a hologram on his omnitool of a half-watery world, "Is Eden Prime. The TSA's proof that it can cooperate and work together with the wider galaxy, and more than that, protect itself and others."

"Something we've worked rather hard at building, if I say so myself," muttered Anderson with more than a hint of pride.

"Indeed. It's billed as a paradise. But… is this a promise that the TSA can live up to?" Jondam began to pace, deactivating the hologram but pulling up a list instead. "Thirteen raids on TSA colonies since the Relay 314 incident, one of which was cited as the direct inspiration for the Purging of Khar'shan. Pirate attacks on the space lanes, genetic experimentation in the Terminus, the Indominus Nest on Melgex… There are those in the Council who believe that your people are a force of chaos, and that by bringing you into the fold, we may have ensured our destruction."

"But," Anderson cut off Shepard's protest, "It is important to remember that the same things were said about the Turians, or any new race to join the Citadel. There's plenty of people who find that our contributions to the galactic scene outweigh the negatives a few… growing pains, could introduce."

"Precisely, Captain. And given the TSA's willingness to stand up not only for itself, but for others, and to integrate with the galactic community, the Council has been in deliberations for a long time- since before Councilor Valern was in office, in fact."

"The reason Jondam is here is not because of the shakedown cruise."

"Well, not the only reason."

"He's here to evaluate you, son."

"Evaluate me? For what?"

"To see if you have what it takes to join the office of Special Tactics and Reconnaissance. "

ACTGACTGACTGACTGACTGACTGACTGACTGACTG

EDEN PRIME

The 212th stared anxiously as Commander Ermine, the only survivor of the first graduating class of the 212th, stood on the stage, clutching a laser pointer in his claws.

"Ladies and gentlebeings, the situation is grim."

Dead silence.

"At 0543 hours Capital Time, an unknown fleet of vessels exited the relay," he brought up a grainy image, showing said fleet in rather poor quality. "Unfortunately, they were using some sort of holographic jamming that we haven't entirely puzzled out yet, making identification of these ships difficult at best. We do know that the fleet has been considered hostile towards us."

He activated the laser pointer, and aimed it at the grainy image. "While our first thought was a slaving run, we have discarded this theory because of the number of ships involved, which at last count was thirty two, and the presence of this ship" he focused it on a very large blurry object, which unlike the other ships, seemed almost organic in design. "While the other ships appear to not have tonnage above cruiser-weight from what we can tell, this behemoth comes in at just over two and a half kilometers long."

A sharp intake of breath could be heard throughout the hall, leading to one raptor embarrassedly ducking his head to hide his outburst.

"Since then, they have proceeded to destroy three monitoring stations while making microjumps across the system, but their destination appears to be us. High Command strongly believes that this," the image changed to that of a set of alien ruins, "Is their true target- the recently unearthed Prothean Ruins on the Eastern Highlands."

"What would they want with the ruins, sir?" asked one daring soldier in the third row.

At Ermine's look of disgust, he quickly added, "I mean there are ruins all across known space, do we know why they would choose to attack here, and not somewhere less defended? Sir?" He added.

Ermine continued to glare, but then nodded. "Better, Lance Corporal Gunny. But no, we do not know why we are being attacked specifically. Hell, the whole 'ruins' theory is just that- a theory, we don't know why they're really attacking. All we know is that when they do get here," his voice raised into a scream, "THE TWO HUNDRED AND TWELVETH WILL BE THERE!"

A loud cheer rose up from the assembled raptors.

"Get to your armor and get kitted out. This is your graduation, soldiers, sorry it couldn't involve more speeches. On the plus side, who the hell has time for that anyway?" A laugh echoed in the hall, "MOVE IT SOLDIERS!"

ACTGACTGACTGACTGACTGACTGACTGACTGACTG

"You're joking."

"That… wasn't the response I was expecting," bemusedly commented Anderson.

"You want to make me a Spectre."

"Actually no, I was hoping for Jix, but she's on Maternity Leave."

Anderson glared at Jondam. Jondam didn't wilt under the four-eyed gaze, but did cough.

"That was a joke. In seriousness, no, we are not looking to make you into a Spectre. We are looking to see if you have what it takes to be trained as a Spectre. Do you think that the Council would just give a 'do anything' license to someone just because they did something impressive once? That would be very silly."

"I thought the Council's official word was that 'Spectres aren't trained, but chosen.'" Argued Shepard.

"Yes, well, The Council sometimes has to say things that sound good to the public, but are somewhat impractical in real life. Plus, rolls off the tongue a little better than 'After examining their records extremely carefully, Spectres are submitted to a rigorous vetting process followed by years of training, and even then most wash out of the program for one reason or another, so good luck beating the spread.'"

"I don't know," Mused Anderson, rubbing his chin, "I'd like to hear that speech."

"You're in the minority, Captain," Jondam replied tartly, "But Shepard. Will you accept?"

"Why was I chosen for this?"

"Well, anti-pirate activity certainly helped… as well as recovering a nearly-intact Prothean Dreadnought, I'm reasonably well informed that several STG members had heart attacks for missing something like that… on a Salarian-owned world." Jondam shook his head ruefully. "You made quite a few enemies that day, commander, showing up the STG like that."

"I can't take all the credit for that- the Pirates were the ones who found it-"

"A fact that I truly believe should be hidden, lest the STG become even more of a laughing stock. Which do you think their pride could handle- having an incredibly important artifact being found under their noses by an elite soldier, or by a group of thugs?"

"Point taken."

"However, the most important even in deciding to extend this offer to you is because of the events on 259-Zeta-736."

"Which planet was-"

"The Omega-Varen, as the Council has designated them."

"Oh."

"You chose to spare the lives of genetically altered varen because they had broken the threshold of sophoncy, according to what you saw in the lab- that is not a decision that everyone could make. Even more, you were willing to defend your position, showing a strength of character that is sorely needed, particularly in the midst of these troubled times. Too often we run into people who believe that the end justifies the means- forgetting that the ends have consequences, not just for the decision-maker, but for others. You showed that you understood this when you let the Omega-Varren go."

Jondam stepped forward, placing his hand on Shepard's shoulder.

"Shepard, we need people like you in the Spectres. Join us, and help make the galaxy a better place."

A long moment passed. Shepard sighed.

"I agree… on one condition."

Jondam looked at Anderson, startled.

"Shepard, I don't think you realize what an honor this is, but you… you're trying to negotiate getting into the Spectres?"

"You match the condition, or I don't join."

Jondam withdrew his hand, looking visibly angrier.

"Name it."

"You tell me how long you were working on that little speech about morality."

Anderson burst out laughing at Jondam's exasperated expression. It only got worse when Jondam sheepishly muttered "Since leaving Sur'kesh…"

ACTGACTGACTGACTGACTGACTGACTGACTGACTG

A roar of hissing met Lance Corporal Ak'ley Williams as she entered the Armory.

All around her, her fellow members of the 212th were kitting out in their special armor, strapping on thrusters and adjusting barrier emitters. One soldier she passed was fiddling with his HUD, only to give a cry of pain as feedback from his 'modifications' sent an electric shock into his ear.

Ak'ley chuckled as she reached her locker and punched in her ten-digit access code. A hiss of pneumatic doors opening and dry-ice smoke- the result of a graduation prank that was lingering longer than expected- revealed her armor. White and red, she carefully attached it to her jumpsuit's hardpoints, going over every seal manually to ensure its quality.

Once this was accomplished she pressed her palm to the back of the locker, on a special raised platform. The panel registered her bio-readings and opened, snaking out several wires which interfaced with her arm's armor. The HUD activated, giving her her motion tracker, GPS, squad status indicator, barrier status, medi-gel dispensers, and more. She withheld a tight, angry hiss as the neural connectors activated, and suddenly she was no longer wearing the suit, she was the suit.

The thrusters, previously recessed into ports in the armor, extended, and gave little chirps as they powered up and pulsed once.

She reached into the locker once last time, grabbing her custom-painted M-101 Crusader shotgun. The superior accuracy and long-range capabilities made it nearly perfect for her, not to mention that it was capable of disemboweling a charging Krogan with one shot. Sure, it didn't have the spread of a normal shotgun, but what was the point?

She let out a very appropriate growl as she got in formation with the other soldiers on the edge of the launch pad. The whine of their jets filled the air.

Commander Ermine stood stoically to the side. "We have confirmed reports that the unknowns have made landing near the ruins. You will be deploying there. Squad Leaders, you know what to do. Keep in touch, trust your pack, and you'll all come out all right." He sighed. "Unfortunately," he announced, "We can't do the full ceremony to induct you all, as I said. However," he raised a claw, "There is one thing I can do for you, a little… Mini-induction before your first battle. I'm going to ask you all some questions… respond as you feel appropriate." He gave a toothy grin.

"SOLDIERS OF THE TWO-TWELVETH!" He roared,

"WHO! ARE YOU!"

"WE ARE THE VELOCIWRECKERS!" Screamed back fifty voices.

"WHAT! DO YOU WANT!"

"TO HUNT THE ENEMY!"

"WHAT DO YOU DO!"

"WE BREAK THE FOE BENEATH OUR CLAWS!"

"HOW DO YOU DO THAT!"

"AS FAST AS POSSIBLE!"

"AND WHERE DO YOU DO IT FROM!"

"FROM! ABOVE!" And with that fifty thruster packs activated, sending the soldiers of the 212th, more commonly known as the Velociwreckers, rocketing into the sky.

ACTGACTGACTGACTGACTGACTGACTGACTGACTG

"The reason we are travelling to Eden Prime- in addition to the relatively safe nature of the system being ideal for a shakedown cruise- is classified, but as you are now being trained to be a Spectre, we can inform you," announced Jondam, very pointedly not looking at Anderson, who was failing to hide a smirk. "On a pass by one of the ground survey satellites, we discovered an extensive set of Prothean ruins. Upon closer examination, the facility is remarkably well preserved, possibly the remains of a bunker complex. We have even managed to find stasis pods containing remarkably well-preserved Protheans, which I'm sure the TSA and the Illuminated Primacy appreciates" with this, he shot a pointed glance at Anderson, who looked as though storm clouds were brewing behind his eyes.

"If this was about some Prothean DNA, then why do we need a prototype stealth frigate? Surely this could be handled by the Uplift Committee?" Shepard asked, ignoring the byplay between the two.

"It's because of what else was recovered- a fully operational Beacon."

Shepard gaped for a second before managing to say "That's… that's significantly more impressive. But still, why a frigate? Why not something like the Ninth Fleet?"

"Politics, son, politics," groused Anderson, "If we sent in the fleet to take the beacon, the Council might think we wanted it for ourselves, or it might make it look like we don't trust our own defenses. Doing this under the radar helps keep things running smoothly in the halls of power."

"That doesn't make sense."

"Shepard, do me a favor and never go into Politics. You're too good of a kid for it."

"A ringing endorsement from a man who tried to strangle a politician."

"That's right, and I'd prefer not to make a second attempt."

"I always knew you cared."

"Hell, no, son, your mother would kill me."

"Uh, captain?" Came Joker's voice over the intercom, "I know you're probably busy right now, but we have a bit of a situation. We're receiving a distress call."

Jondam and Anderson shot looks to one another. "Is it on the way to Eden Prime?"

"Sir, it is Eden Prime."

Anderson's eyes widened, then barked "Reroute that call to the Communications Center! We'll be right there! Best speed to Eden Prime!"

"Got it, That'll be…" the com cut out as the door closed behind the three sprinting males, Shepard in the lead, occasionally calling out "MAKE A HOLE!" to anyone who got in the way.

As the three skidded into the Communications Center, the intercom crackled to life again "… Forty-seven minutes until we're in position, Captain. Maybe wait until I'm done? You know it's rude to leave in the middle of a-"

"Joker…" growled the Martian.

"All right, all right, I get it. Patching it through."

At this, a holographic window opened in midair in front of them… And Hell was unleashed.

ACTGACTGACTGACTGACTGACTGACTGACTGACTG

"This is Communications Technician First Grade Moloch! We are under attack! I repeat, we are under attack by unknown forces! They hit the capital and the central garrison first, and have started moving to the Prothean dig site! If anyone can hear this, send help immediately! Someone contact the Alliance or the Council, there's… Oh my god!"

The camera had been focused on a Triceratops, while barrages of bullets echoed in the sky above, tracers cutting lines across lines of Pterodactyls, who returned fire with gusto. Suddenly, the camera jerked to the side in time to reveal a group of Raptors in fully-enclosed armor firing at targets off-screen, only for one of them to fall to the ground, its head a mass of shattered gore. Then a second one crumpled to the ground, its organs slumping out of the sudden large opening it now had in its chest. A third ignited its boosters and dashed across the clearing, only for a rocket to loop around and slam into him. The final one turned to the camera and screamed, "What the hell are you doing?! RUN!"

The cameraman and Moloch turned visibly, only to be placed briefly face-to-face with a hulking monstrosity, wielding an assault rifle the size of a sniper rifle… there was a loud noise, and the video ended.

ACTGACTGACTGACTGACTGACTGACTGACTGACTG

"Go back ten seconds," Anderson ordered. The video danced backwards until it focused on the unknown alien. "Freeze!"

The alien had its huge assault rifle pointed at the camera, held in a massively bulky arm. Its head was triangular, with a rounded bottom- a completely enclosed helmet covered its features, but two glowing blue lights indicated that it was binocular. The legs were swept back, but were roughly asarinoid. The arms were strangely thin, and coated in what appeared to be a glowing blue substance. From the footage, it was clear that it was some kind of fluid just under the surface. The chest was covered in a green set of armor, with prominent delta symbols covering it to the point that it looked like a suit of chain mail.

"I've… I've never seen something like this," admitted Anderson, only to be cut off by Jondam.

"I have," he hissed, eyes narrowed in anger. "The Lystheni."

At the looks of confusion on his companions' faces, Jondam hastened to explain. "The Terrans aren't the only ones with multiple races sharing the same homeworld… The Lystheni are an offshoot of our race, similar to how the humans have the Neanderthals, or the Velociraptors have the microraptors."

He wiped a hand over his eyes. "The problem was religious in origin- the Salarians believed in the wheel, where we would be reincarnated into the next life once we pass on. It's our duty to do so, to make sure that there are enough souls for the next generation."

Shepard quirked an eyebrow. "That would work if the population remained the same, and the birth/death ratio was identical, but what would happen once the population expanded? Wouldn't that mean that there are those without souls?"

Jondam waved him off, "I'm generalizing something that is extremely complex, and it's hardly the strangest thing to come out of religion- some Hanar believe that John Hammond was divinely inspired by the Protheans to "Recreate their majesty," even though he died over a hundred years before the first Martians were decanted. Sometimes faith doesn't have to make perfect logical sense. But back on the point, we believed that it was our duty to live our lives, and die when it came time to. The Lystheni believed that their bodies were nothing more than vessels for their souls, and that new souls were created when a new person was born, the old souls travelling to the divine beyond. However, they also believed that they were judged based on what they had done with their lives. So they came to the conclusion that the more they lived, the better their odds were in the afterlife. So they took whatever means possible to live longer for more life experience."

Jondam pointed at the figure on the screen. "The Lystheni began to experiment on animals and on themselves to figure out the many ways to become better or stronger. Their experimentation unleashed terrible monsters- the likes of which make your "Bio-Wars" seem like a walk in the park, and were eventually exiled from Salarian space."

Bau sighed. "What you are looking at is the result of nearly two millennia of eugenics, genetic modifications, and cybernetics research in order to gain immortality. They live longer, are stronger, and likely have artificial body parts that can compensate for if part of them is damaged or destroyed."

"So why attack us?" Anderson folded his arms as he said this. "We haven't heard of them before, I can't think of a reason they'd attack us… aside from the beacon, of course."

"That… is a very good question. Even when we lived together on Sur'kesh, they tended to isolate themselves from us, a practice that continued once they entered the galactic stage. Their home systems are very far away from major populated trade routes, and they shoot down ships that come too close to their worlds. It doesn't make sense why they would journey so far away to go after something like this here…"

"Well, whatever the reason, they're here now. How do we kill them?" asked Shepard matter-of-factly.

"I'm assuming a bullet between the eyes will do, Commander," dryly remarked the captain.

"Simplistic as it seems, your captain is correct. They, like us, have standard asarinoid physiology, so torso or head shots should work, once you penetrate the armor and barriers. However, as I stated, they may have synthetic organs or cybernetic implants, not to mention an extremely robust genetic structure, so they will not be easy to take down."

"That's it?"

"Much as we wish otherwise, there is no single, surefire way to kill every sentient in the galaxy. Sophont life has a remarkable ability to maintain itself even under extreme pressure- I once met a human on a job who had survived a point-blank gunshot wound in the head, and all he said was 'Rage is a hell of an anesthetic.'"

"So we're dealing with cyborg salarians who are attacking us for no discernable reason and may not go down to gunfire. Just another day in the corps, eh, sir?"

"Quite, Shepard. Now get the ground team ready, we have work to do."

ACTGACTGACTGACTGACTGACTGACTGACTGACTG

Weapons fire continued to chatter on in the distance, but it was becoming clear to all who heard it that it was becoming more and more sporadic. No longer did the titanic surface-to-space guns sound off for all to hear, their emplacements burned to scrap by rays of red light deployed by the massive dreadnought which had somehow landed on the planet, but Ak'ley Williams did not care about miniscule details like this. She was far more concerned with her inability to contact other members of the 212th, or anyone else, for that matter.

"Come on, come on…" she muttered from beneath the titanic tree trunk she had chosen for a hiding spot. "Work, damn you!" she burst out, slapping her wrist with her claws.

A brief burst of static was all that she got for her troubles, as well as a series of crunching noises that were slowly getting louder.

She froze, and swiftly turned off the radio, but the noises continued to increase in volume. Carefully, Ak'ley pulled a fallen branch over herself, just in time for four figures to burst into a nearby clearing.

Lystheni, covered in their odd glowing chain mail armor, with several small drones floating around them, carefully took glances around, before one of them stiffened, and to Ak'ley's shock and dismay, he was facing directly where she was hiding.

As one, the four advanced on her hiding place, until another series of thunderous booms filled the air. Then everyone, even the hidden Raptor, looked up to see what looked like a low-flying Alliance Frigate swooping over the horizon and dropping several objects just over the hill.

ACTGACTGACTGACTGACTGACTGACTGACTGACTG

"Shepard! Is your team ready to drop?" yelled the Salarian SPECTRE over the howling wind. Stephen nodded, his face invisible under his armor-plated helmet, and then he glanced back at his team. The three of them stood ready, weapons magnetically attached to their hardsuits and all three glowing faintly from their barriers.

The first member was the young ensign he had met earlier, Richard L. Jenkins. His shoulder had the crimson fist emblem that indicated that he was part of the demolitions corps, and he wore a bandoleer of grenades across the forest-green chestplate of his suit. Attached to his back was the venerable M-102 Piranha, a powerful shotgun with a large circular heat sink. His hands nervously drummed on the handle of his M-3 Predator, which he appeared to be holding in a death grip.

"Loosen up on that weapon, marine," barked Stephen, and the ensign reluctantly did so.

The second member was, to Stephen's well-travelled eyes, the single largest Martian he had ever seen. Easily massing as much as a young Krogan, the four-eyed man was nonchalantly leaning against the wall, his M-76 Revenant scraping against his grenade launcher as he shifted his position slightly. Like his comrades, his armor was forest green, though he had a yellow cannon logo printed on his shoulder, indicating that his specialty was in heavy weapons.

"Lieutenant Vega, Eyes On Me," Stephen intoned, and in response the burly Martian stiffened into an at-attention pose.

The final member was much slimmer than the other two, and on his shoulder, he bore the Blue Brain logo that indicated he was one of the very rare human biotics. His armor was, in contrast to his companions, a deeper shade of green, the color of moss. At his sides were two pistols- the first an M-77 Paladin, and the other an M-358 Talon.

"Lieutenant-Commander Alenko, barrier check. You good to go?"

"Affirmative, Commander," came the response.

"All right, we drop in-"

"Actually," interrupted the salarian, "I drop first." When the squad shot him a look, he raised his hands in a conciliatory gesture and explained, "It's not that I don't appreciate the Alliance wanting to watch my back, but I was STG, and I am a SPECTRE. If there is one individual here who can scout ahead most effectively, it would be me." He finished speaking just as the ship jolted slightly, and the ground stopped rushing as fast. "Sorry about this, but I'll see you at the beacon!" he popped a quick salute and hopped out the open hatch.

Stephen rolled his eyes under his helm, before mentally counting down. After a few seconds, he activated the squad radio to his three other team members. "This is Shepard, mike check."

"James Vega, Check."

"Richard Jenkins, Check."

"Kaiden Alenko, Check."

"Roger. We drop in Five. Three… one… Now!"

The four sprinted off of the edge of the ramp, hurtling themselves into the open air as their built-in Mass Effect cores kicked in, slowing their descent and diverting power from the barriers to generating contra-gravity forces. Stephen's helmet transmitted the vibrations as the tiny core worked overtime to try to protect itself and its user, as the ground got larger, and larger…

Until finally, with four loud reports, the squad slammed down in the middle of a small river, sending up large, watery blasts into the air. Gasbags, startled from their feeding on the local algae, moved as quickly as they could in fright. For a moment, the only sounds were those of droplets falling back to the water, and the distant sounds of gunfire.

Suddenly, a green figure erupted out of the water, followed by three more, as they trudged as quickly as they could towards the surface. "Anyone hurt?" asked their leader, which was responded to by three negatives. "Good," Commander Shepard grimly stated as he took his M-103 Valkyrie and gripped it tightly, pleased to see his subordinates grabbing their own weapons.

"Because we have a mission to complete."

Codex: The Terran System Alliance

The Terran Systems Alliance was first introduced to the Citadel Council in an event termed "The First Contact War," by the Alliance, and the "Relay 317 Skirmish" by the Turian Hierarchy, a minor conflict that ended with both the sudden appearance of the Alliance Fifth Fleet and Asari Diplomats.

First Contact with the Alliance was curious, as in this one single meeting brought more species into the Galactic Civilization than the previous six first contacts combined. Unlike the Citadel, though, which is a conglomeration of multiple races who achieved spaceflight independently and banded together for mutual cooperation, the Alliance was born when the founding race, Humans, literally cloned new life forms out of previously extinct species.

The Alliance's principle claim to fame is their mastery of understanding genetics and cloning technology. Pioneered by the InGen corporation in the year 1993 CE, their first project was the resurrection of multiple multi-million year extinct fossils, collectively known as "Dinosaurs" by humans. While initially successful, the project ran into major issues due to a combination of industrial sabotage, and inexperience of dealing with the creatures. By the year 2015 CE, the process of cloning these creatures had been smoothed out, enabling the company to sell the rights to these creatures for various purposes- law enforcement, military, food, pets, and more. Within five years, what were extinct animals were extremely common.

In 2032, a monumental event in Alliance history happened- it was conclusively proven that a subtype of Dinosaur, known colloquially as "Raptors," were as intelligent as humans, demonstrated when a Raptor- named "Lazuli" after her rich blue plumage- was able to hold an entire conversation with researchers in sign language. Human Rights lobbyists, led by Owen Grady and an aged Ian Malcom, quickly began putting pressure on national governments to begin passing "Sapient Rights Laws," to protect the rights of their creations, while in the background their geneticists went over the Raptor DNA and brain scans to find out exactly what made them tick.

It was swiftly uncovered that due to the radically different atmospheric composition between when the Raptors originally came from to the present day, their physiology couldn't handle it. To adjust their creations to the air of modern-day earth, neurological tissue of the raptors was grafted with DNA of Ravens, which were already considered semi-sentient in their own right. Combined with Dinosaur brain structures, the raptors were pushed into full-on sentience.

Looking back through records, researchers found that four other dinosaur species had this particular upgrade added to their genetic code: Ceratopsians, Dilophosaurus, Pteranodons... and to the shock of many, Tyrannosaurus Rex.

With the greatest of care, UN Scientists and Human Rights groups slowly approached members of these races, and after careful examination, determined that all four of these were, in fact, as self-aware as any human being. Lazuli and her pack, descendants of the first Raptors used in the Jurassic Park experiment, offered to make contact with these groups, using their sign language to help interpret Dinosaur Language.

By the year 2045, Each of the emerging sentient races had managed to make contact with humanity, and had started to form organized governments. This process was completed in 2052, when Thinks-Through-Fear slew Round-River-Hunter for control of the various groups of Tyrannosaurus.

In 2060, the United Nations officially recognized the governments of the Five Herds, representing the five species, as the official authorities in charge of Isla Nublar, as well as granting official status as living beings with the same rights as humans. This was followed by official support from Pope Thomas of South Africa, who stated that "Any who can choose to seek God's love of their own free will is no different than you or I."

By the year 2099, thanks in part to emigration and increased cloning production, Saurians had spread out to all corners of the world... and were about to take the logical next step, joining the humans on the Alderson Martian expedition. While not the first terrans to visit the Red Planet, this was the first multi-species crew to do so. What no one knew later was that this would be the least talked about aspect of this mission.

The races of Earth were about to enter into the interstellar stage, as the Adlerson Expedition discovered the ruins of a Prothean outpost, as well as a small element zero cache... and a perfectly preserved, fifty-thousand-year-old Prothean corpse.

The nations of Earth, realizing that extraterrestrial life could potentially prove hazardous to life on earth, banded together to form the Terran Systems Alliance, as well as commissioning studies into the alien technology in order to help protect the earth and to move beyond their fragile homeworld. As the speaker of the Alliance Parliment, Calms-Rough-Waters, claimed, "My people were once wiped from existence by threats from beyond the sky. This shall never happen again."

Earth's first long-range Colony Ship, the Ark Royal, was completed in 2131 CE, and left the Solar System for Alpha Centauri the same day that the first living Prothean in over fifty thousand years was decanted from the cloning facilities of Nueva Nublar.

When representatives of the various species under the umbrella of the Alliance met representatives of the Citadel Council, members of seven species-including living, breathing Protheans- were in attendance.

While the re-introduction of Protheans has gone over well with many races, friction still exists between the Alliance and other members of the Council. Their complete disregard of genetic engineering laws, while useful in some cases, chaffed at more studious members of the council, as did their rapid advancement in front of races that had been members for years.

Recently, the Batarian Hegemony has threatened war with the Alliance over the destruction of their Torfan colony. Alliance representatives claim that it was in retaliation for the assault by Hegemony-backed pirates on the Alliance colony of Elyssium, while Hegemony representatives state that there is no proof that the pirates were Hegemony-backed, and that Commander Herds-Prey-Beast's actions count as war crimes.