AAATAGCGTGCCCTTGGAATGGTTGAGCGTGTTATGTAGGAGGATCTCGAGATGGCGGATCTTGTCATGCTGGGCGTAGCTCGTGGAGTTATGGATGGAATGGTTGAGCTTATGGTCGGCTAAGCGGTGATGCAGGATGTCCTTATGCGTGGACTGATGGACGTACGTGGAGTTATGGTTGAGCTTATGTCAGGCTAAGGAGACATGCTAGGCTCAATGGTTGAGCTTATGGGGGGCTAGCTTGTAATGGTTGGCATGGATGGAGAAGCGTAACTTGGACTCCTTATGGTTGAGCTTATGTAGGGCGTAGCGCTGGTG
A man with short, silver white hair and a bandage over one eye looked up at the hull of the Flames of Youth. He frowned at the strange name, but shrugged and elbowed the seventeen year old kid standing next to him.
"Hey, Naruto. Aren't you happy that she's finally finished? We've been working so damn hard these past ten months."
The blond, blue eyed youngster grinned at his lax superior and said, "It sure was a journey, Mr. Hatake! I hope one day that I get to take one of these ships to other parts of the world to see what the people are like there and what kind of ships they build."
"Heh… don't call me mister, kid. It makes me feel old."
Naruto blinked and said, "You aren't?"
The man frowned and said, "Naruto, I'm only ten years older than you."
Naruto nodded. "Oh… that's still pretty old, though."
He laughed and shook his head. "Ah well. Can't be helped, I suppose. You're just young and too gosh-darn polite to call me by anything other than my family name, huh? I may have been your superior during this job, but you showed initiative and a good sense of teamwork, and I respect that. If you respect me also, then you should call me Kakashi, Naruto."
Naruto turned to look at his super and nodded. "Alright, Kakashi, sir."
Kakashi chuckled. "Well, that's a start, I suppose… ah, so what places would you go to if you ever got a chance to get on one of these ships?"
Naruto smiled easily and said, "Republic City, of course!"
He laughed at the young blond's enthusiasm and nodded, saying, "Sure, that's a good place to start. I went there as a kid myself. Me and my dad worked there when I was your age, actually. That's where I learned my trade to be able to work here."
Naruto looked down at his beaten and calloused hands. He smiled. "So these hands of mine already have a taste of what Republic City is like, then, huh?"
Kakashi looked at him in a confused manner until it dawned on him what it was the blond meant. "Oh, well, yeah, I guess so, kid. You learned pretty much all I had to teach you over this past year. Everything I learned in the Avatar's City, you learned here."
Naruto nodded and clenched both of his hands into tight fists as he chuckled and said, "I almost didn't want it to end…"
Kakashi arched a brow. "Oh?"
"Yes… I mean… it was so much fun getting to know everyone… there was always something new to work on and it kept me busy and taught me an important skill since I probably won't ever go to school like other kids."
Kakashi nodded. "You left early, didn't you? I think I remember you telling me that you had to stop going to school to go help your parents out with their fishing and delivery business together with your father's friend."
Naruto nodded. "Yeah, Mr. Jiraiya," he said, reminding Kakashi of the old man's name. "My pops got this weird pain in his left arm though that keeps him from being able to do a lot of stuff. Every time he lifts something or moves too fast with it it's like his arm just gives out. He almost killed himself trying to chop some firewood the other day. Ma's tried to take over for him with some help from me, but it hasn't been easy."
"Yeah, it must be rough to be a small time fisherman in a place like this, with all of these ships going out there."
Naruto shook his head, "My dad still knows all of the best spots, so we always get a good haul. Plus, Ma's strong as an ox so it pretty much balances itself out."
Kakashi smirked. "Huh, that so? They ever need a hand, you should tell them to get in touch with me. I'm always looking for extra work when we're off season here at the shipyard."
Naruto's eyebrows raised in surprise. He grinned and said, "Definitely! You work harder than anyone else I know, Kakashi, sir! You'd be a great addition to our crew!"
Kakashi chuckled. "Alright, kid. Head on home now. Your parents will receive your pay in the mail in two weeks. You know how it goes."
Naruto groaned and nodded. "Yeah… I know… doesn't mean I have to like it."
They glanced at one another and both of them shared a laugh as they shook hands and parted ways for the afternoon.
Naruto, three months away from turning eighteen, walked home that night from the shipyard where he worked to the comfy, small-town home owned by his father and his mother.
News of the Avatar's address to the world spread to the far ends of the planet as quickly as messengers could take them. A recording of her voice, telling everyone that they would have to work together in order for both the physical and the spirit world to exist cohesively, was both inspiring and breathtaking. When it played on his radio at his home in the Fire Nation, Naruto knew he couldn't sit idly by while the rest of the world ventured into this fantastic adventure led by the Avatar herself.
He needed to see what was going on with his own two eyes. Not just hear it on some silly little box that tried, ineptly, to describe what was going on in Republic City, the Southern Water Tribe and the rest of the world.
He sat down and spoke to both of his parents later that evening. He told them how he had been saving money for several years now working odd jobs at the shipyard. They knew that this was the first year that he was really hired to do some of the more important work on the ship's hull, foundation and overall structure, but they were surprised to find out just how much he had learned over the course of a couple of years, especially in the last year while under Kakashi's supervision.
He told them he thought he had enough to head over to Republic City and then even a little more left over to bide him some time to find work there, hopefully at another shipyard or somewhere similar. He said he didn't want to leave them, but he felt deep inside that somehow he was meant to be a part of the whole unification of the spirit and the physical worlds. It called to him, he said, the adventure he had dreamed about since he could walk had called to him on the radio that afternoon.
The next morning, they looked upset to see him leave, but his father Minato patted him firmly on the shoulder and said, "That-a-boy. It's about time you went off on your own, son."
Kushina, his mother, smiled solemnly and nodded, saying, "You will write, won't you? Please don't leave me wondering if my little boy is alright out there in the big city."
Naruto smiled. "I will, Ma."
Minato grinned at his kid and rubbed his knuckle into the top of his skull, making his son wince in discomfort. "Bring back a wife, when you come visit."
Kushina glowered at her husband, slightly annoyed that he would even say such a thing. "He's far too young to be thinking about raising his own family, Minato! He's going off on his own now. The last thing he wants to do is get tied down before his journey even starts!"
Naruto rolled his eyes, "I'm not going to get tied down."
Kushina frowned and looked at her son. "You are too good-natured, Naruto. You need this trip. It's going to toughen you up since your father was completely useless in that department. But it won't work if you go and lie down with the first city girl you meet out there! Promise me that you won't trust them easily, no matter how pretty or how smart or funny they are."
Minato took this opportunity to roll his eyes as he turned away from his wife, hoping she didn't catch that gesture. When he felt her dig her fist into the muscles of his lower back, he yelped and moved several feet away from her just in case she tried it again.
Naruto grinned at his two loveable oafs for parents and nodded. "I promise I'll be wary of girls, especially the pretty ones."
Kushina smiled at her son and kissed him on the forehead, saying, "Good. Your momma should be the most important girl in your life, you little brat."
He chuckled and kissed his mother on the cheek, then stood up and started walking out the door. He stopped and turned around to say, "My last check's coming in the mail. I had them make it out to you guys so you can go ahead and cash it in. It's everything I made for the past three months. Hopefully it helps a bit since I'm gone… also, make sure you check up on mister Hatake like I told you. He said he was interested in working out on deck with you and mister Jiraiya… I love you mom… dad." He stepped past the threshold not knowing that it would be years before he returned. He thought his adventure lay in the journey to see the Avatar, not realizing that when he made the choice to leave that evening, he altered his destiny more than he could ever realize.
Minato and Kushina smiled at their son and stood up to see him out. They knew where he was going. They heard the Avatar's statement on the radio. They also heard that the large vessel that he and hundreds of others had been working on for months, the Flames of Youth, would be making its maiden voyage later on that afternoon to none other than Republic City.
=A T G C=
Disclaimer: I do not own Naruto or Avatar: The Legend of Korra. Those rights go to their respectful owners, and this is just purely for fun and not-for-profit.
Author's Note: Hello everyone. I took a break from writing Winds to work out this story idea I had for another crossover fic. This, I will let you know now, is going to be a NarutoxAsami fanfic. Yes, I know, right? I've been asked several times to write one, and so I thought this might be a good way to introduce the two characters together. The "A T G C" combination at the top is not spam. It's code. That's my hint. If you need help, check my profile for more info on it. I'm going to focus this story on the idea of genetics and what it really means to pass the bending "gene" down from person to person.
I have a lot of research to do for this story (I'm not sure how long it takes after a ship is built before they start offering tickets, for instance, maybe they do it beforehand?), but it's going to have to wait until after my classes are done. I hope you enjoyed, and if you did please let me know. I may not continue this right away depending on the amount of interest there is in it. If I do, I may rework this chapter and I will let you know in the second or subsequent chapters what I've changed or what I've added to enhance the story :)
Thank you for all of the people who have already followed me through my other stories or from my art, and I hope you all do well in your school in these last couple of weeks (months?) you might have.